Back to Build/check report for BioC 3.17 |
|
This page was generated on 2023-02-08 01:15:32 -0000 (Wed, 08 Feb 2023).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
kunpeng1 | Linux (Ubuntu 22.04.1 LTS) | aarch64 | R Under development (unstable) (2023-01-14 r83615) -- "Unsuffered Consequences" | 4164 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
To the developers/maintainers of the TFBSTools package: - Please allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/TFBSTools.git to reflect on this report. See How and When does the builder pull? When will my changes propagate? for more information. - Make sure to use the following settings in order to reproduce any error or warning you see on this page. |
Package 2024/2164 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
TFBSTools 1.37.0 (landing page) Ge Tan
| kunpeng1 | Linux (Ubuntu 22.04.1 LTS) / aarch64 | OK | OK | ERROR | |||||||||
Package: TFBSTools |
Version: 1.37.0 |
Command: /home/biocbuild/bbs-3.17-bioc/R/bin/R CMD check --install=check:TFBSTools.install-out.txt --library=/home/biocbuild/bbs-3.17-bioc/R/library --timings TFBSTools_1.37.0.tar.gz |
StartedAt: 2023-02-07 17:29:49 -0000 (Tue, 07 Feb 2023) |
EndedAt: 2023-02-07 17:36:52 -0000 (Tue, 07 Feb 2023) |
EllapsedTime: 422.7 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: TFBSTools.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.17-bioc/R/bin/R CMD check --install=check:TFBSTools.install-out.txt --library=/home/biocbuild/bbs-3.17-bioc/R/library --timings TFBSTools_1.37.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.17-bioc/meat/TFBSTools.Rcheck’ * using R Under development (unstable) (2023-01-14 r83615) * using platform: aarch64-unknown-linux-gnu (64-bit) * R was compiled by gcc (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0 GNU Fortran (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0 * running under: Ubuntu 22.04.1 LTS * using session charset: UTF-8 * checking for file ‘TFBSTools/DESCRIPTION’ ... OK * checking extension type ... Package * this is package ‘TFBSTools’ version ‘1.37.0’ * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘TFBSTools’ can be installed ... OK * used C compiler: ‘gcc (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0’ * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... NOTE Unexported objects imported by ':::' calls: ‘S4Vectors:::new_SimpleList_from_list’ ‘seqLogo:::pwm2ic’ See the note in ?`:::` about the use of this operator. * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... OK * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... OK * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘TFBSTools-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: SiteSetList > ### Title: Class '"SiteSetList"' > ### Aliases: SiteSetList SiteSetList-class as.data.frame,SiteSetList-method > ### relScore,SiteSetList-method pvalues,SiteSetList-method > ### Keywords: classes > > ### ** Examples > > data(MA0003.2) > data(MA0004.1) > pwmList <- PWMatrixList(MA0003.2=toPWM(MA0003.2), MA0004.1=toPWM(MA0004.1)) > sitesetList <- searchSeq(pwmList, "GAATTCTCTCTTGTTGTAGTCTCTTGACAAAATG", + min.score="50%") > > ## elementNROWS of each pwm hits > library(S4Vectors) Loading required package: stats4 Loading required package: BiocGenerics Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:stats’: IQR, mad, sd, var, xtabs The following objects are masked from ‘package:base’: Filter, Find, Map, Position, Reduce, anyDuplicated, aperm, append, as.data.frame, basename, cbind, colnames, dirname, do.call, duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted, lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin, pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table, tapply, union, unique, unsplit, which.max, which.min Attaching package: ‘S4Vectors’ The following objects are masked from ‘package:base’: I, expand.grid, unname > elementNROWS(sitesetList) MA0003.2 MA0004.1 13 7 > > ## Output of SiteSetList > writeGFF3(sitesetList, scoreType="absolute") seqname source feature start end score strand frame MA0003.2.1 Unknown TFBS TFBS 2 16 -27.623703 + . MA0003.2.2 Unknown TFBS TFBS 3 17 -24.560384 + . MA0003.2.3 Unknown TFBS TFBS 5 19 -24.037513 + . MA0003.2.4 Unknown TFBS TFBS 8 22 -19.709791 + . MA0003.2.5 Unknown TFBS TFBS 15 29 -20.516907 + . MA0003.2.6 Unknown TFBS TFBS 16 30 -20.207857 + . MA0003.2.7 Unknown TFBS TFBS 4 18 -25.859889 - . MA0003.2.8 Unknown TFBS TFBS 5 19 -26.980302 - . MA0003.2.9 Unknown TFBS TFBS 7 21 -18.813417 - . MA0003.2.10 Unknown TFBS TFBS 11 25 -25.701717 - . MA0003.2.11 Unknown TFBS TFBS 17 31 -26.900540 - . MA0003.2.12 Unknown TFBS TFBS 18 32 -16.437682 - . MA0003.2.13 Unknown TFBS TFBS 20 34 -25.203202 - . MA0004.1.1 Unknown TFBS TFBS 8 13 -1.888154 + . MA0004.1.2 Unknown TFBS TFBS 21 26 -1.888154 + . MA0004.1.3 Unknown TFBS TFBS 29 34 -3.908935 + . MA0004.1.4 Unknown TFBS TFBS 6 11 -7.908935 - . MA0004.1.5 Unknown TFBS TFBS 8 13 -1.961403 - . MA0004.1.6 Unknown TFBS TFBS 10 15 -3.908935 - . MA0004.1.7 Unknown TFBS TFBS 21 26 -1.961403 - . attributes MA0003.2.1 TF=TFAP2A;class=Zipper-Type;sequence=AATTCTCTCTTGTTG MA0003.2.2 TF=TFAP2A;class=Zipper-Type;sequence=ATTCTCTCTTGTTGT MA0003.2.3 TF=TFAP2A;class=Zipper-Type;sequence=TCTCTCTTGTTGTAG MA0003.2.4 TF=TFAP2A;class=Zipper-Type;sequence=CTCTTGTTGTAGTCT MA0003.2.5 TF=TFAP2A;class=Zipper-Type;sequence=TGTAGTCTCTTGACA MA0003.2.6 TF=TFAP2A;class=Zipper-Type;sequence=GTAGTCTCTTGACAA MA0003.2.7 TF=TFAP2A;class=Zipper-Type;sequence=TACAACAAGAGAGAA MA0003.2.8 TF=TFAP2A;class=Zipper-Type;sequence=CTACAACAAGAGAGA MA0003.2.9 TF=TFAP2A;class=Zipper-Type;sequence=GACTACAACAAGAGA MA0003.2.10 TF=TFAP2A;class=Zipper-Type;sequence=AAGAGACTACAACAA MA0003.2.11 TF=TFAP2A;class=Zipper-Type;sequence=TTTGTCAAGAGACTA MA0003.2.12 TF=TFAP2A;class=Zipper-Type;sequence=TTTTGTCAAGAGACT MA0003.2.13 TF=TFAP2A;class=Zipper-Type;sequence=CATTTTGTCAAGAGA MA0004.1.1 TF=Arnt;class=Zipper-Type;sequence=CTCTTG MA0004.1.2 TF=Arnt;class=Zipper-Type;sequence=CTCTTG MA0004.1.3 TF=Arnt;class=Zipper-Type;sequence=AAAATG MA0004.1.4 TF=Arnt;class=Zipper-Type;sequence=AGAGAG MA0004.1.5 TF=Arnt;class=Zipper-Type;sequence=CAAGAG MA0004.1.6 TF=Arnt;class=Zipper-Type;sequence=AACAAG MA0004.1.7 TF=Arnt;class=Zipper-Type;sequence=CAAGAG > as(sitesetList, "DataFrame") DataFrame with 20 rows and 12 columns seqnames source feature start end absScore relScore strand <Rle> <Rle> <Rle> <integer> <integer> <numeric> <numeric> <Rle> 1 Unknown TFBS TFBS 2 16 -27.6237 0.502950 + 2 Unknown TFBS TFBS 3 17 -24.5604 0.534919 + 3 Unknown TFBS TFBS 5 19 -24.0375 0.540376 + 4 Unknown TFBS TFBS 8 22 -19.7098 0.585540 + 5 Unknown TFBS TFBS 15 29 -20.5169 0.577117 + ... ... ... ... ... ... ... ... ... 16 Unknown TFBS TFBS 29 34 -3.90894 0.614134 + 17 Unknown TFBS TFBS 6 11 -7.90894 0.513016 - 18 Unknown TFBS TFBS 8 13 -1.96140 0.663367 - 19 Unknown TFBS TFBS 10 15 -3.90894 0.614134 - 20 Unknown TFBS TFBS 21 26 -1.96140 0.663367 - ID TF class siteSeqs <Rle> <Rle> <Rle> <DNAStringSet> 1 MA0003.2 TFAP2A Zipper-Type AATTCTCTCTTGTTG 2 MA0003.2 TFAP2A Zipper-Type ATTCTCTCTTGTTGT 3 MA0003.2 TFAP2A Zipper-Type TCTCTCTTGTTGTAG 4 MA0003.2 TFAP2A Zipper-Type CTCTTGTTGTAGTCT 5 MA0003.2 TFAP2A Zipper-Type TGTAGTCTCTTGACA ... ... ... ... ... 16 MA0004.1 Arnt Zipper-Type AAAATG 17 MA0004.1 Arnt Zipper-Type AGAGAG 18 MA0004.1 Arnt Zipper-Type CAAGAG 19 MA0004.1 Arnt Zipper-Type AACAAG 20 MA0004.1 Arnt Zipper-Type CAAGAG > as(sitesetList, "data.frame") seqnames source feature start end absScore relScore strand ID 1 Unknown TFBS TFBS 2 16 -27.623703 0.5029502 + MA0003.2 2 Unknown TFBS TFBS 3 17 -24.560384 0.5349192 + MA0003.2 3 Unknown TFBS TFBS 5 19 -24.037513 0.5403760 + MA0003.2 4 Unknown TFBS TFBS 8 22 -19.709791 0.5855404 + MA0003.2 5 Unknown TFBS TFBS 15 29 -20.516907 0.5771173 + MA0003.2 6 Unknown TFBS TFBS 16 30 -20.207857 0.5803426 + MA0003.2 7 Unknown TFBS TFBS 4 18 -25.859889 0.5213575 - MA0003.2 8 Unknown TFBS TFBS 5 19 -26.980302 0.5096648 - MA0003.2 9 Unknown TFBS TFBS 7 21 -18.813417 0.5948950 - MA0003.2 10 Unknown TFBS TFBS 11 25 -25.701717 0.5230082 - MA0003.2 11 Unknown TFBS TFBS 17 31 -26.900540 0.5104972 - MA0003.2 12 Unknown TFBS TFBS 18 32 -16.437682 0.6196884 - MA0003.2 13 Unknown TFBS TFBS 20 34 -25.203202 0.5282107 - MA0003.2 14 Unknown TFBS TFBS 8 13 -1.888154 0.6652185 + MA0004.1 15 Unknown TFBS TFBS 21 26 -1.888154 0.6652185 + MA0004.1 16 Unknown TFBS TFBS 29 34 -3.908935 0.6141340 + MA0004.1 17 Unknown TFBS TFBS 6 11 -7.908935 0.5130158 - MA0004.1 18 Unknown TFBS TFBS 8 13 -1.961403 0.6633668 - MA0004.1 19 Unknown TFBS TFBS 10 15 -3.908935 0.6141340 - MA0004.1 20 Unknown TFBS TFBS 21 26 -1.961403 0.6633668 - MA0004.1 TF class siteSeqs 1 TFAP2A Zipper-Type AATTCTCTCTTGTTG 2 TFAP2A Zipper-Type ATTCTCTCTTGTTGT 3 TFAP2A Zipper-Type TCTCTCTTGTTGTAG 4 TFAP2A Zipper-Type CTCTTGTTGTAGTCT 5 TFAP2A Zipper-Type TGTAGTCTCTTGACA 6 TFAP2A Zipper-Type GTAGTCTCTTGACAA 7 TFAP2A Zipper-Type TACAACAAGAGAGAA 8 TFAP2A Zipper-Type CTACAACAAGAGAGA 9 TFAP2A Zipper-Type GACTACAACAAGAGA 10 TFAP2A Zipper-Type AAGAGACTACAACAA 11 TFAP2A Zipper-Type TTTGTCAAGAGACTA 12 TFAP2A Zipper-Type TTTTGTCAAGAGACT 13 TFAP2A Zipper-Type CATTTTGTCAAGAGA 14 Arnt Zipper-Type CTCTTG 15 Arnt Zipper-Type CTCTTG 16 Arnt Zipper-Type AAAATG 17 Arnt Zipper-Type AGAGAG 18 Arnt Zipper-Type CAAGAG 19 Arnt Zipper-Type AACAAG 20 Arnt Zipper-Type CAAGAG > as.data.frame(sitesetList) seqnames source feature start end absScore relScore strand ID 1 Unknown TFBS TFBS 2 16 -27.623703 0.5029502 + MA0003.2 2 Unknown TFBS TFBS 3 17 -24.560384 0.5349192 + MA0003.2 3 Unknown TFBS TFBS 5 19 -24.037513 0.5403760 + MA0003.2 4 Unknown TFBS TFBS 8 22 -19.709791 0.5855404 + MA0003.2 5 Unknown TFBS TFBS 15 29 -20.516907 0.5771173 + MA0003.2 6 Unknown TFBS TFBS 16 30 -20.207857 0.5803426 + MA0003.2 7 Unknown TFBS TFBS 4 18 -25.859889 0.5213575 - MA0003.2 8 Unknown TFBS TFBS 5 19 -26.980302 0.5096648 - MA0003.2 9 Unknown TFBS TFBS 7 21 -18.813417 0.5948950 - MA0003.2 10 Unknown TFBS TFBS 11 25 -25.701717 0.5230082 - MA0003.2 11 Unknown TFBS TFBS 17 31 -26.900540 0.5104972 - MA0003.2 12 Unknown TFBS TFBS 18 32 -16.437682 0.6196884 - MA0003.2 13 Unknown TFBS TFBS 20 34 -25.203202 0.5282107 - MA0003.2 14 Unknown TFBS TFBS 8 13 -1.888154 0.6652185 + MA0004.1 15 Unknown TFBS TFBS 21 26 -1.888154 0.6652185 + MA0004.1 16 Unknown TFBS TFBS 29 34 -3.908935 0.6141340 + MA0004.1 17 Unknown TFBS TFBS 6 11 -7.908935 0.5130158 - MA0004.1 18 Unknown TFBS TFBS 8 13 -1.961403 0.6633668 - MA0004.1 19 Unknown TFBS TFBS 10 15 -3.908935 0.6141340 - MA0004.1 20 Unknown TFBS TFBS 21 26 -1.961403 0.6633668 - MA0004.1 TF class siteSeqs 1 TFAP2A Zipper-Type AATTCTCTCTTGTTG 2 TFAP2A Zipper-Type ATTCTCTCTTGTTGT 3 TFAP2A Zipper-Type TCTCTCTTGTTGTAG 4 TFAP2A Zipper-Type CTCTTGTTGTAGTCT 5 TFAP2A Zipper-Type TGTAGTCTCTTGACA 6 TFAP2A Zipper-Type GTAGTCTCTTGACAA 7 TFAP2A Zipper-Type TACAACAAGAGAGAA 8 TFAP2A Zipper-Type CTACAACAAGAGAGA 9 TFAP2A Zipper-Type GACTACAACAAGAGA 10 TFAP2A Zipper-Type AAGAGACTACAACAA 11 TFAP2A Zipper-Type TTTGTCAAGAGACTA 12 TFAP2A Zipper-Type TTTTGTCAAGAGACT 13 TFAP2A Zipper-Type CATTTTGTCAAGAGA 14 Arnt Zipper-Type CTCTTG 15 Arnt Zipper-Type CTCTTG 16 Arnt Zipper-Type AAAATG 17 Arnt Zipper-Type AGAGAG 18 Arnt Zipper-Type CAAGAG 19 Arnt Zipper-Type AACAAG 20 Arnt Zipper-Type CAAGAG > as(sitesetList, "GRanges") GRanges object with 20 ranges and 8 metadata columns: seqnames ranges strand | source feature absScore relScore ID <Rle> <IRanges> <Rle> | <Rle> <Rle> <numeric> <numeric> <Rle> [1] Unknown 2-16 + | TFBS TFBS -27.6237 0.502950 MA0003.2 [2] Unknown 3-17 + | TFBS TFBS -24.5604 0.534919 MA0003.2 [3] Unknown 5-19 + | TFBS TFBS -24.0375 0.540376 MA0003.2 [4] Unknown 8-22 + | TFBS TFBS -19.7098 0.585540 MA0003.2 [5] Unknown 15-29 + | TFBS TFBS -20.5169 0.577117 MA0003.2 ... ... ... ... . ... ... ... ... ... [16] Unknown 29-34 + | TFBS TFBS -3.90894 0.614134 MA0004.1 [17] Unknown 6-11 - | TFBS TFBS -7.90894 0.513016 MA0004.1 [18] Unknown 8-13 - | TFBS TFBS -1.96140 0.663367 MA0004.1 [19] Unknown 10-15 - | TFBS TFBS -3.90894 0.614134 MA0004.1 [20] Unknown 21-26 - | TFBS TFBS -1.96140 0.663367 MA0004.1 TF class siteSeqs <Rle> <Rle> <DNAStringSet> [1] TFAP2A Zipper-Type AATTCTCTCTTGTTG [2] TFAP2A Zipper-Type ATTCTCTCTTGTTGT [3] TFAP2A Zipper-Type TCTCTCTTGTTGTAG [4] TFAP2A Zipper-Type CTCTTGTTGTAGTCT [5] TFAP2A Zipper-Type TGTAGTCTCTTGACA ... ... ... ... [16] Arnt Zipper-Type AAAATG [17] Arnt Zipper-Type AGAGAG [18] Arnt Zipper-Type CAAGAG [19] Arnt Zipper-Type AACAAG [20] Arnt Zipper-Type CAAGAG ------- seqinfo: 1 sequence from an unspecified genome; no seqlengths > > ## Calculate the p-values > pvalues(sitesetList, type="TFMPvalue") Killed * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes in ‘inst/doc’ ... OK * checking running R code from vignettes ... ‘TFBSTools.Rmd’ using ‘UTF-8’... OK NONE * checking re-building of vignette outputs ... ERROR Error(s) in re-building vignettes: ... --- re-building ‘TFBSTools.Rmd’ using rmarkdown Killed * checking PDF version of manual ... OK * DONE Status: 2 ERRORs, 2 NOTEs See ‘/home/biocbuild/bbs-3.17-bioc/meat/TFBSTools.Rcheck/00check.log’ for details.
TFBSTools.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.17-bioc/R/bin/R CMD INSTALL TFBSTools ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.17-bioc/R/library’ * installing *source* package ‘TFBSTools’ ... ** using staged installation ** libs using C compiler: ‘gcc (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0’ gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I/usr/local/include -fPIC -g -O2 -Wall -c matrixAlignerDynamic.c -o matrixAlignerDynamic.o matrixAlignerDynamic.c: In function ‘score’: matrixAlignerDynamic.c:235:22: warning: ‘best_pntr’ may be used uninitialized in this function [-Wmaybe-uninitialized] 235 | while (current_pntr->father != NULL){ // while the father of the current pointer exists, walk through the best posible alignment | ~~~~~~~~~~~~^~~~~~~~ gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I/usr/local/include -fPIC -g -O2 -Wall -c R_init_TFBSTools.c -o R_init_TFBSTools.o gcc -shared -L/home/biocbuild/bbs-3.17-bioc/R/lib -L/usr/local/lib -o TFBSTools.so matrixAlignerDynamic.o R_init_TFBSTools.o -L/home/biocbuild/bbs-3.17-bioc/R/lib -lR installing to /home/biocbuild/bbs-3.17-bioc/R/library/00LOCK-TFBSTools/00new/TFBSTools/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading Creating a new generic function for ‘seqLogo’ in package ‘TFBSTools’ ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** checking absolute paths in shared objects and dynamic libraries ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (TFBSTools)
TFBSTools.Rcheck/tests/testthat.Rout
R Under development (unstable) (2023-01-14 r83615) -- "Unsuffered Consequences" Copyright (C) 2023 The R Foundation for Statistical Computing Platform: aarch64-unknown-linux-gnu (64-bit) R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > library(testthat) > library(TFBSTools) > > test_check("TFBSTools") [ FAIL 0 | WARN 0 | SKIP 0 | PASS 34 ] > > proc.time() user system elapsed 18.023 0.644 19.017
TFBSTools.Rcheck/TFBSTools-Ex.timings
name | user | system | elapsed | |
IUPAC2Matrix | 0.002 | 0.000 | 0.001 | |
MA0004.1 | 0.003 | 0.002 | 0.005 | |
MotifSet-class | 0 | 0 | 0 | |
PFMSimilarity-methods | 0.337 | 0.012 | 0.381 | |
PWMSimilarity-methods | 0.011 | 0.000 | 0.012 | |
SiteSet-class | 9.556 | 0.072 | 9.636 | |