| Back to Build/check report for BioC 3.17: simplified long |
|
This page was generated on 2023-02-27 02:34:30 -0000 (Mon, 27 Feb 2023).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| kunpeng1 | Linux (Ubuntu 22.04.1 LTS) | aarch64 | R Under development (unstable) (2023-01-14 r83615) -- "Unsuffered Consequences" | 4259 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
|
To the developers/maintainers of the Biostrings package: - Please allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/Biostrings.git to reflect on this report. See How and When does the builder pull? When will my changes propagate? for more information. - Make sure to use the following settings in order to reproduce any error or warning you see on this page. |
| Package 200/2169 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| Biostrings 2.67.0 (landing page) H. Pagès
| kunpeng1 | Linux (Ubuntu 22.04.1 LTS) / aarch64 | OK | OK | ERROR | |||||||||
| Package: Biostrings |
| Version: 2.67.0 |
| Command: /home/biocbuild/bbs-3.17-bioc/R/bin/R CMD check --install=check:Biostrings.install-out.txt --library=/home/biocbuild/bbs-3.17-bioc/R/library --timings Biostrings_2.67.0.tar.gz |
| StartedAt: 2023-02-24 07:57:12 -0000 (Fri, 24 Feb 2023) |
| EndedAt: 2023-02-24 08:07:49 -0000 (Fri, 24 Feb 2023) |
| EllapsedTime: 636.9 seconds |
| RetCode: 1 |
| Status: ERROR |
| CheckDir: Biostrings.Rcheck |
| Warnings: NA |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.17-bioc/R/bin/R CMD check --install=check:Biostrings.install-out.txt --library=/home/biocbuild/bbs-3.17-bioc/R/library --timings Biostrings_2.67.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.17-bioc/meat/Biostrings.Rcheck’
* using R Under development (unstable) (2023-01-14 r83615)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
gcc (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0
GNU Fortran (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0
* running under: Ubuntu 22.04.1 LTS
* using session charset: UTF-8
* checking for file ‘Biostrings/DESCRIPTION’ ... OK
* this is package ‘Biostrings’ version ‘2.67.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘Biostrings’ can be installed ... OK
* used C compiler: ‘gcc (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0’
* checking installed package size ... NOTE
installed size is 14.6Mb
sub-directories of 1Mb or more:
R 1.7Mb
extdata 11.1Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
Package listed in more than one of Depends, Imports, Suggests, Enhances:
‘methods’
A package should be listed in only one of these fields.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
Unexported objects imported by ':::' calls:
‘BiocGenerics:::testPackage’ ‘IRanges:::.showAtomicList’
‘IRanges:::from_Vector_to_CompressedList’
‘IRanges:::new_CompressedList_from_list’ ‘IRanges:::new_Views’
‘IRanges:::regroupBySupergroup’ ‘IRanges:::show_IntegerRangesList’
‘IRanges:::unlist_as_integer’ ‘S4Vectors:::anyMissingOrOutside’
‘XVector:::close_filexp’
‘XVector:::extract_character_from_XRaw_by_positions’
‘XVector:::extract_character_from_XRaw_by_ranges’
‘XVector:::new_XVectorList_from_list_of_XVector’
‘XVector:::open_output_file’
See the note in ?`:::` about the use of this operator.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... WARNING
checkRd: (5) AAString-class.Rd:74-78: \item in \describe must have non-empty label
checkRd: (5) AAString-class.Rd:86-92: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:87-90: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:91-96: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:97-99: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:100-103: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:104-107: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:108-111: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:112-116: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:117-121: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:122-125: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:126-129: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:130-133: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:134-137: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:138-141: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:147-151: \item in \describe must have non-empty label
checkRd: (5) AlignedXStringSet-class.Rd:152-156: \item in \describe must have non-empty label
checkRd: (5) DNAString-class.Rd:57-61: \item in \describe must have non-empty label
checkRd: (5) DNAString-class.Rd:69-75: \item in \describe must have non-empty label
checkRd: (5) InDel-class.Rd:32-35: \item in \describe must have non-empty label
checkRd: (5) InDel-class.Rd:36-39: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:49-52: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:53-56: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:57-61: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:62-66: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:67-71: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:79-83: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:91-99: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:110-115: \item in \describe must have non-empty label
checkRd: (5) MIndex-class.Rd:116-119: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:113-116: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:117-122: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:123-140: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:141-145: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:146-152: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:160-164: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:165-168: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:169-172: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:180-185: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:193-197: \item in \describe must have non-empty label
checkRd: (5) MaskedXString-class.Rd:198-203: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:157-161: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:162-167: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:168-178: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:179-189: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:190-200: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:201-216: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:217-220: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:221-224: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:225-228: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:229-232: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:233-236: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:237-240: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:241-244: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:245-249: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:250-253: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:261-267: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:268-274: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:275-282: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:290-298: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:299-304: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:305-312: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:313-320: \item in \describe must have non-empty label
checkRd: (5) MultipleAlignment-class.Rd:321-337: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:241-244: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:245-249: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:250-253: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:254-257: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:258-261: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:262-269: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:270-273: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:282-285: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:294-297: \item in \describe must have non-empty label
checkRd: (5) PDict-class.Rd:298-301: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:154-160: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:161-165: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:166-169: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:177-180: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:181-187: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:188-193: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:202-210: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:211-214: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:215-218: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:219-222: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:230-234: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:235-238: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:239-243: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:244-250: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:258-262: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:263-268: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:269-274: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:275-279: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:280-283: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:284-289: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:295-299: \item in \describe must have non-empty label
checkRd: (5) PairwiseAlignments-class.Rd:300-304: \item in \describe must have non-empty label
checkRd: (5) QualityScaledXStringSet-class.Rd:111-114: \item in \describe must have non-empty label
checkRd: (5) QualityScaledXStringSet-class.Rd:115-119: \item in \describe must have non-empty label
checkRd: (5) QualityScaledXStringSet-class.Rd:120-123: \item in \describe must have non-empty label
checkRd: (5) QualityScaledXStringSet-class.Rd:124-129: \item in \describe must have non-empty label
checkRd: (5) QualityScaledXStringSet-class.Rd:130-133: \item in \describe must have non-empty label
checkRd: (5) QualityScaledXStringSet-class.Rd:143-146: \item in \describe must have non-empty label
checkRd: (5) RNAString-class.Rd:55-59: \item in \describe must have non-empty label
checkRd: (5) RNAString-class.Rd:67-73: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:94-98: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:106-111: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:112-115: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:123-126: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:127-130: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:138-148: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:156-169: \item in \describe must have non-empty label
checkRd: (5) XString-class.Rd:170-173: \item in \describe must have non-empty label
checkRd: (5) XStringPartialMatches-class.Rd:32-35: \item in \describe must have non-empty label
checkRd: (5) XStringPartialMatches-class.Rd:36-39: \item in \describe must have non-empty label
checkRd: (5) XStringPartialMatches-class.Rd:49-54: \item in \describe must have non-empty label
checkRd: (-1) XStringQuality-class.Rd:86: Escaped LaTeX specials: \#
checkRd: (5) XStringQuality-class.Rd:106-109: \item in \describe must have non-empty label
checkRd: (5) XStringQuality-class.Rd:111-115: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:116-118: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:119-121: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:122-124: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:135-138: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:139-145: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:146-155: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:156-162: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:163-166: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:176-193: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:194-204: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:205-215: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:216-221: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:231-234: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:235-238: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:239-242: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:251-254: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:255-258: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:259-262: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:263-266: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:275-280: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:281-286: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:287-290: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:291-298: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:299-302: \item in \describe must have non-empty label
checkRd: (5) XStringSet-class.Rd:303-311: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:55-65: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:66-72: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:80-85: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:86-90: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:91-94: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:95-98: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:106-109: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:110-113: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:122-126: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:127-131: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:141-143: \item in \describe must have non-empty label
checkRd: (5) XStringSet-comparison.Rd:144-146: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:73-77: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:87-93: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:103-117: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:118-121: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:122-131: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:136-143: \item in \describe must have non-empty label
checkRd: (5) XStringViews-class.Rd:144-147: \item in \describe must have non-empty label
checkRd: (5) injectHardMask.Rd:58-61: \item in \describe must have non-empty label
checkRd: (5) injectHardMask.Rd:62-70: \item in \describe must have non-empty label
checkRd: (5) injectHardMask.Rd:71-74: \item in \describe must have non-empty label
checkRd: (-1) matchLRPatterns.Rd:65: Escaped LaTeX specials: \_ \_
checkRd: (-1) matchProbePair.Rd:53: Escaped LaTeX specials: \_ \_
checkRd: (-1) matchProbePair.Rd:54: Escaped LaTeX specials: \_ \_
checkRd: (-1) matchProbePair.Rd:55: Escaped LaTeX specials: \_ \_
checkRd: (-1) matchProbePair.Rd:56: Escaped LaTeX specials: \_ \_
checkRd: (-1) phiX174Phage.Rd:18: Escaped LaTeX specials: \_
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... WARNING
Undocumented code objects:
‘strsplit’ ‘twoWayAlphabetFrequency’
Undocumented S4 methods:
generic 'match' and siglist 'Vector,XStringSet'
generic 'match' and siglist 'XStringSet,Vector'
generic 'match' and siglist 'XStringSet,vector'
generic 'match' and siglist 'vector,XStringSet'
generic 'parallel_slot_names' and siglist 'ByPos_MIndex'
generic 'parallel_slot_names' and siglist 'MIndex'
generic 'pcompare' and siglist 'Vector,XStringSet'
generic 'pcompare' and siglist 'XStringSet,Vector'
generic 'pcompare' and siglist 'XStringSet,vector'
generic 'pcompare' and siglist 'vector,XStringSet'
generic 'relistToClass' and siglist 'XString'
generic 'strsplit' and siglist 'XStringSet'
generic 'twoWayAlphabetFrequency' and siglist 'XString,XString'
generic 'twoWayAlphabetFrequency' and siglist 'XString,XStringSet'
generic 'twoWayAlphabetFrequency' and siglist 'XStringSet,XString'
generic 'twoWayAlphabetFrequency' and siglist 'XStringSet,XStringSet'
generic 'unstrsplit' and siglist 'XStringSet'
generic 'unstrsplit' and siglist 'XStringSetList'
All user-level objects in a package (including S4 classes and methods)
should have documentation entries.
See chapter ‘Writing R documentation files’ in the ‘Writing R
Extensions’ manual.
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘Biostrings-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: matchPDict
> ### Title: Matching a dictionary of patterns against a reference
> ### Aliases: matchPDict-exact matchPDict matchPDict,XString-method
> ### matchPDict,XStringSet-method matchPDict,XStringViews-method
> ### matchPDict,MaskedXString-method countPDict countPDict,XString-method
> ### countPDict,XStringSet-method countPDict,XStringViews-method
> ### countPDict,MaskedXString-method whichPDict whichPDict,XString-method
> ### whichPDict,XStringSet-method whichPDict,XStringViews-method
> ### whichPDict,MaskedXString-method vmatchPDict vmatchPDict,ANY-method
> ### vmatchPDict,XString-method vmatchPDict,MaskedXString-method
> ### vcountPDict vcountPDict,XString-method vcountPDict,XStringSet-method
> ### vcountPDict,XStringViews-method vcountPDict,MaskedXString-method
> ### vwhichPDict vwhichPDict,XString-method vwhichPDict,XStringSet-method
> ### vwhichPDict,XStringViews-method vwhichPDict,MaskedXString-method
> ### extractAllMatches
> ### Keywords: methods
>
> ### ** Examples
>
> ## ---------------------------------------------------------------------
> ## A. A SIMPLE EXAMPLE OF EXACT MATCHING
> ## ---------------------------------------------------------------------
>
> ## Creating the pattern dictionary:
> library(drosophila2probe)
Loading required package: AnnotationDbi
Loading required package: Biobase
Welcome to Bioconductor
Vignettes contain introductory material; view with
'browseVignettes()'. To cite Bioconductor, see
'citation("Biobase")', and for packages 'citation("pkgname")'.
> dict0 <- DNAStringSet(drosophila2probe)
> dict0 # The original dictionary.
DNAStringSet object of length 265400:
width seq
[1] 25 CCTGAATCCTGGCAATGTCATCATC
[2] 25 ATCCTGGCAATGTCATCATCAATGG
[3] 25 ATCAGTTGTCAACGGCTAATACGCG
[4] 25 ATCAATGGCGATTGCCGCGTCTGCA
[5] 25 CCGCGTCTGCAATGTGAGGGCCTAA
... ... ...
[265396] 25 TACTACTTGAGCCACAACCATCTGA
[265397] 25 AGGGACTAAAGAGGCCCCATGCTCT
[265398] 25 CATGCTCTGTCTGGTGTCAGCGCTA
[265399] 25 GTCAGCGCTACATGGTCCAGGACAA
[265400] 25 CCAGGACAAGTATGGACTTCCCCAC
> length(dict0) # Hundreds of thousands of patterns.
[1] 265400
> pdict0 <- PDict(dict0) # Store the original dictionary in
> # a PDict object (preprocessing).
>
> ## Using the pattern dictionary on chromosome 3R:
> library(BSgenome.Dmelanogaster.UCSC.dm3)
Loading required package: BSgenome
Loading required package: GenomicRanges
Loading required package: rtracklayer
> chr3R <- Dmelanogaster$chr3R # Load chromosome 3R
> chr3R
27905053-letter DNAString object
seq: GAATTCTCTCTTGTTGTAGTCTCTTGACAAAATGCA...TATGTCGCAGCGTGACTGTTCGCATTCTAGGAATTC
> mi0 <- matchPDict(pdict0, chr3R) # Search...
>
> ## Looking at the matches:
> start_index <- startIndex(mi0) # Get the start index.
> length(start_index) # Same as the original dictionary.
[1] 265400
> start_index[[8220]] # Starts of the 8220th pattern.
[1] 6788511 9806158 23620037
> end_index <- endIndex(mi0) # Get the end index.
> end_index[[8220]] # Ends of the 8220th pattern.
[1] 6788535 9806182 23620061
> nmatch_per_pat <- elementNROWS(mi0) # Get the number of matches per pattern.
> nmatch_per_pat[[8220]]
[1] 3
> mi0[[8220]] # Get the matches for the 8220th pattern.
IRanges object with 3 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
[1] 6788511 6788535 25
[2] 9806158 9806182 25
[3] 23620037 23620061 25
> start(mi0[[8220]]) # Equivalent to startIndex(mi0)[[8220]].
[1] 6788511 9806158 23620037
> sum(nmatch_per_pat) # Total number of matches.
[1] 32993
> table(nmatch_per_pat)
nmatch_per_pat
0 1 2 3 4 5 6 7 8 9 10
233623 31208 341 42 92 44 21 3 8 4 13
12
1
> i0 <- which(nmatch_per_pat == max(nmatch_per_pat))
> pdict0[[i0]] # The pattern with most occurrences.
25-letter DNAString object
seq: AAGGAAGTTGCACGCTGCACTGTCG
> mi0[[i0]] # Its matches as an IRanges object.
IRanges object with 12 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
[1] 27806218 27806242 25
[2] 27806784 27806808 25
[3] 27807348 27807372 25
[4] 27807630 27807654 25
[5] 27807912 27807936 25
... ... ... ...
[8] 27809042 27809066 25
[9] 27809325 27809349 25
[10] 27809607 27809631 25
[11] 27809889 27809913 25
[12] 27810997 27811021 25
> Views(chr3R, mi0[[i0]]) # And as an XStringViews object.
Views on a 27905053-letter DNAString subject
subject: GAATTCTCTCTTGTTGTAGTCTCTTGACAAAATG...TGTCGCAGCGTGACTGTTCGCATTCTAGGAATTC
views:
start end width
[1] 27806218 27806242 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[2] 27806784 27806808 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[3] 27807348 27807372 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[4] 27807630 27807654 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[5] 27807912 27807936 25 [AAGGAAGTTGCACGCTGCACTGTCG]
... ... ... ... ...
[8] 27809042 27809066 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[9] 27809325 27809349 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[10] 27809607 27809631 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[11] 27809889 27809913 25 [AAGGAAGTTGCACGCTGCACTGTCG]
[12] 27810997 27811021 25 [AAGGAAGTTGCACGCTGCACTGTCG]
>
> ## Get the coverage of the original subject:
> cov3R <- as.integer(coverage(mi0, width=length(chr3R)))
> max(cov3R)
[1] 10
> mean(cov3R)
[1] 0.02955827
> sum(cov3R != 0) / length(cov3R) # Only 2.44% of chr3R is covered.
[1] 0.02441407
> if (interactive()) {
+ plotCoverage <- function(cx, start, end)
+ {
+ plot.new()
+ plot.window(c(start, end), c(0, 20))
+ axis(1)
+ axis(2)
+ axis(4)
+ lines(start:end, cx[start:end], type="l")
+ }
+ plotCoverage(cov3R, 27600000, 27900000)
+ }
>
> ## ---------------------------------------------------------------------
> ## B. NAMING THE PATTERNS
> ## ---------------------------------------------------------------------
>
> ## The names of the original patterns, if any, are propagated to the
> ## PDict and MIndex objects:
> names(dict0) <- mkAllStrings(letters, 4)[seq_len(length(dict0))]
> dict0
DNAStringSet object of length 265400:
width seq names
[1] 25 CCTGAATCCTGGCAATGTCATCATC aaaa
[2] 25 ATCCTGGCAATGTCATCATCAATGG aaab
[3] 25 ATCAGTTGTCAACGGCTAATACGCG aaac
[4] 25 ATCAATGGCGATTGCCGCGTCTGCA aaad
[5] 25 CCGCGTCTGCAATGTGAGGGCCTAA aaae
... ... ...
[265396] 25 TACTACTTGAGCCACAACCATCTGA pcpn
[265397] 25 AGGGACTAAAGAGGCCCCATGCTCT pcpo
[265398] 25 CATGCTCTGTCTGGTGTCAGCGCTA pcpp
[265399] 25 GTCAGCGCTACATGGTCCAGGACAA pcpq
[265400] 25 CCAGGACAAGTATGGACTTCCCCAC pcpr
> dict0[["abcd"]]
25-letter DNAString object
seq: CCTCTCAGAGAAACCCACACAAAAA
> pdict0n <- PDict(dict0)
> names(pdict0n)[1:30]
[1] "aaaa" "aaab" "aaac" "aaad" "aaae" "aaaf" "aaag" "aaah" "aaai" "aaaj"
[11] "aaak" "aaal" "aaam" "aaan" "aaao" "aaap" "aaaq" "aaar" "aaas" "aaat"
[21] "aaau" "aaav" "aaaw" "aaax" "aaay" "aaaz" "aaba" "aabb" "aabc" "aabd"
> pdict0n[["abcd"]]
25-letter DNAString object
seq: CCTCTCAGAGAAACCCACACAAAAA
> mi0n <- matchPDict(pdict0n, chr3R)
> names(mi0n)[1:30]
[1] "aaaa" "aaab" "aaac" "aaad" "aaae" "aaaf" "aaag" "aaah" "aaai" "aaaj"
[11] "aaak" "aaal" "aaam" "aaan" "aaao" "aaap" "aaaq" "aaar" "aaas" "aaat"
[21] "aaau" "aaav" "aaaw" "aaax" "aaay" "aaaz" "aaba" "aabb" "aabc" "aabd"
> mi0n[["abcd"]]
IRanges object with 0 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
>
> ## This is particularly useful when unlisting an MIndex object:
> unlist(mi0)[1:10]
IRanges object with 10 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
[1] 16069898 16069922 25
[2] 16069961 16069985 25
[3] 16070066 16070090 25
[4] 16070081 16070105 25
[5] 16070100 16070124 25
[6] 16070112 16070136 25
[7] 16070136 16070160 25
[8] 16070159 16070183 25
[9] 16070174 16070198 25
[10] 16070192 16070216 25
> unlist(mi0n)[1:10] # keep track of where the matches are coming from
IRanges object with 10 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
aadu 16069898 16069922 25
aadv 16069961 16069985 25
aadw 16070066 16070090 25
aadx 16070081 16070105 25
aady 16070100 16070124 25
aadz 16070112 16070136 25
aaea 16070136 16070160 25
aaeb 16070159 16070183 25
aaec 16070174 16070198 25
aaed 16070192 16070216 25
>
> ## ---------------------------------------------------------------------
> ## C. PERFORMANCE
> ## ---------------------------------------------------------------------
>
> ## If getting the number of matches is what matters only (without
> ## regarding their positions), then countPDict() will be faster,
> ## especially when there is a high number of matches:
>
> nmatch_per_pat0 <- countPDict(pdict0, chr3R)
> stopifnot(identical(nmatch_per_pat0, nmatch_per_pat))
>
> if (interactive()) {
+ ## What's the impact of the dictionary width on performance?
+ ## Below is some code that can be used to figure out (will take a long
+ ## time to run). For different widths of the original dictionary, we
+ ## look at:
+ ## o pptime: preprocessing time (in sec.) i.e. time needed for
+ ## building the PDict object from the truncated input
+ ## sequences;
+ ## o nnodes: nb of nodes in the resulting Aho-Corasick tree;
+ ## o nupatt: nb of unique truncated input sequences;
+ ## o matchtime: time (in sec.) needed to find all the matches;
+ ## o totalcount: total number of matches.
+ getPDictStats <- function(dict, subject)
+ {
+ ans_width <- width(dict[1])
+ ans_pptime <- system.time(pdict <- PDict(dict))[["elapsed"]]
+ pptb <- pdict@threeparts@pptb
+ ans_nnodes <- nnodes(pptb)
+ ans_nupatt <- sum(!duplicated(pdict))
+ ans_matchtime <- system.time(
+ mi0 <- matchPDict(pdict, subject)
+ )[["elapsed"]]
+ ans_totalcount <- sum(elementNROWS(mi0))
+ list(
+ width=ans_width,
+ pptime=ans_pptime,
+ nnodes=ans_nnodes,
+ nupatt=ans_nupatt,
+ matchtime=ans_matchtime,
+ totalcount=ans_totalcount
+ )
+ }
+ stats <- lapply(8:25,
+ function(width)
+ getPDictStats(DNAStringSet(dict0, end=width), chr3R))
+ stats <- data.frame(do.call(rbind, stats))
+ stats
+ }
>
> ## ---------------------------------------------------------------------
> ## D. USING A NON-PREPROCESSED DICTIONARY
> ## ---------------------------------------------------------------------
>
> dict3 <- DNAStringSet(mkAllStrings(DNA_BASES, 3)) # all trinucleotides
> dict3
DNAStringSet object of length 64:
width seq
[1] 3 AAA
[2] 3 AAC
[3] 3 AAG
[4] 3 AAT
[5] 3 ACA
... ... ...
[60] 3 TGT
[61] 3 TTA
[62] 3 TTC
[63] 3 TTG
[64] 3 TTT
> pdict3 <- PDict(dict3)
>
> ## The 3 following calls are equivalent (from faster to slower):
> res3a <- countPDict(pdict3, chr3R)
> res3b <- countPDict(dict3, chr3R)
> res3c <- sapply(dict3,
+ function(pattern) countPattern(pattern, chr3R))
> stopifnot(identical(res3a, res3b))
> stopifnot(identical(res3a, res3c))
>
> ## One reason for using a non-preprocessed dictionary is to get rid of
> ## all the constraints associated with preprocessing, e.g., when
> ## preprocessing with PDict(), the input dictionary must be DNA and a
> ## Trusted Band must be defined (explicitly or implicitly).
> ## See '?PDict' for more information about these constraints.
> ## In particular, using a non-preprocessed dictionary can be
> ## useful for the kind of inexact matching that can't be achieved
> ## with a PDict object (if performance is not an issue).
> ## See '?`matchPDict-inexact`' for more information about inexact
> ## matching.
>
> dictD <- xscat(dict3, "N", reverseComplement(dict3))
>
> ## The 2 following calls are equivalent (from faster to slower):
> resDa <- matchPDict(dictD, chr3R, fixed=FALSE)
> resDb <- sapply(dictD,
+ function(pattern)
+ matchPattern(pattern, chr3R, fixed=FALSE))
> stopifnot(all(sapply(seq_len(length(dictD)),
+ function(i)
+ identical(resDa[[i]], as(resDb[[i]], "IRanges")))))
>
> ## A non-preprocessed dictionary can be of any base class i.e. BString,
> ## RNAString, and AAString, in addition to DNAString:
> matchPDict(AAStringSet(c("DARC", "EGH")), AAString("KMFPRNDEGHSTTWTEE"))
MIndex object of length 2
[[1]]
IRanges object with 0 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
[[2]]
IRanges object with 1 range and 0 metadata columns:
start end width
<integer> <integer> <integer>
[1] 8 10 3
>
> ## ---------------------------------------------------------------------
> ## E. vcountPDict()
> ## ---------------------------------------------------------------------
>
> ## Load Fly upstream sequences (i.e. the sequences 2000 bases upstream of
> ## annotated transcription starts):
> dm3_upstream_filepath <- system.file("extdata",
+ "dm3_upstream2000.fa.gz",
+ package="Biostrings")
> dm3_upstream <- readDNAStringSet(dm3_upstream_filepath)
> dm3_upstream
DNAStringSet object of length 26454:
width seq names
[1] 2000 GTTGGTGGCCCACCAGTGCCA...CAAGTTTACCGGTTGCACGGT NM_078863_up_2000...
[2] 2000 TTATTTATGTAGGCGCCCGTT...ATACGGAAAGTCATCCTCGAT NM_001201794_up_2...
[3] 2000 TTATTTATGTAGGCGCCCGTT...ATACGGAAAGTCATCCTCGAT NM_001201795_up_2...
[4] 2000 TTATTTATGTAGGCGCCCGTT...ATACGGAAAGTCATCCTCGAT NM_001201796_up_2...
[5] 2000 TTATTTATGTAGGCGCCCGTT...ATACGGAAAGTCATCCTCGAT NM_001201797_up_2...
... ... ...
[26450] 2000 ATTTACAAGACTAATAAAGAT...AAAATTAAATTTCAATAAAAC NM_001111010_up_2...
[26451] 2000 GATATACGAAGGACGACCTGC...TTGTTTGAGTTGTTATATATT NM_001015258_up_2...
[26452] 2000 GATATACGAAGGACGACCTGC...TTGTTTGAGTTGTTATATATT NM_001110997_up_2...
[26453] 2000 GATATACGAAGGACGACCTGC...TTGTTTGAGTTGTTATATATT NM_001276245_up_2...
[26454] 2000 CGTATGTATTAGTTAACTCTG...TCAAAGTGTAAGAACAAATTG NM_001015497_up_2...
>
> subject <- dm3_upstream[1:100]
> mat1 <- vcountPDict(pdict0, subject)
> dim(mat1) # length(pdict0) x length(subject)
[1] 265400 100
> nhit_per_probe <- rowSums(mat1)
> table(nhit_per_probe)
nhit_per_probe
0 1 2 3 8 9
265217 82 59 14 14 14
>
> ## Without vcountPDict(), 'mat1' could have been computed with:
> mat2 <- sapply(unname(subject), function(x) countPDict(pdict0, x))
> stopifnot(identical(mat1, mat2))
> ## but using vcountPDict() is faster (10x or more, depending of the
> ## average length of the sequences in 'subject').
>
> if (interactive()) {
+ ## This will fail (with message "allocMatrix: too many elements
+ ## specified") because, on most platforms, vectors and matrices in R
+ ## are limited to 2^31 elements:
+ subject <- dm3_upstream
+ vcountPDict(pdict0, subject)
+ length(pdict0) * length(dm3_upstream)
+ 1 * length(pdict0) * length(dm3_upstream) # > 2^31
+ ## But this will work:
+ nhit_per_seq <- vcountPDict(pdict0, subject, collapse=2)
+ sum(nhit_per_seq >= 1) # nb of subject sequences with at least 1 hit
+ table(nhit_per_seq) # max is 74
+ which.max(nhit_per_seq) # 1133
+ sum(countPDict(pdict0, subject[[1133]])) # 74
+ }
>
> ## ---------------------------------------------------------------------
> ## F. RELATIONSHIP BETWEEN vcountPDict(), countPDict() AND
> ## vcountPattern()
> ## ---------------------------------------------------------------------
> subject <- dm3_upstream
>
> ## The 4 following calls are equivalent (from faster to slower):
> mat3a <- vcountPDict(pdict3, subject)
> mat3b <- vcountPDict(dict3, subject)
> mat3c <- sapply(dict3,
+ function(pattern) vcountPattern(pattern, subject))
> mat3d <- sapply(unname(subject),
+ function(x) countPDict(pdict3, x))
> stopifnot(identical(mat3a, mat3b))
> stopifnot(identical(mat3a, t(mat3c)))
> stopifnot(identical(mat3a, mat3d))
>
> ## The 3 following calls are equivalent (from faster to slower):
> nhitpp3a <- vcountPDict(pdict3, subject, collapse=1) # rowSums(mat3a)
> nhitpp3b <- vcountPDict(dict3, subject, collapse=1)
> nhitpp3c <- sapply(dict3,
+ function(pattern) sum(vcountPattern(pattern, subject)))
Killed
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘run_unitTests.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ...
‘Biostrings2Classes.Rnw’ using ‘UTF-8’... OK
‘BiostringsQuickOverview.Rnw’ using ‘UTF-8’... OK
‘MultipleAlignments.Rnw’ using ‘UTF-8’... OK
‘PairwiseAlignments.Rnw’ using ‘UTF-8’... OK
‘matchprobes.Rnw’ using ‘UTF-8’... OK
OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE
Status: 1 ERROR, 2 WARNINGs, 4 NOTEs
See
‘/home/biocbuild/bbs-3.17-bioc/meat/Biostrings.Rcheck/00check.log’
for details.
Biostrings.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.17-bioc/R/bin/R CMD INSTALL Biostrings
###
##############################################################################
##############################################################################
* installing to library ‘/home/biocbuild/bbs-3.17-bioc/R/library’
* installing *source* package ‘Biostrings’ ...
** using staged installation
** libs
using C compiler: ‘gcc (Ubuntu 11.3.0-1ubuntu1~22.04) 11.3.0’
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c BAB_class.c -o BAB_class.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c BitMatrix.c -o BitMatrix.o
BitMatrix.c:299:13: warning: ‘BitMatrix_print’ defined but not used [-Wunused-function]
299 | static void BitMatrix_print(BitMatrix *bitmat)
| ^~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c IRanges_stubs.c -o IRanges_stubs.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c MIndex_class.c -o MIndex_class.o
MIndex_class.c: In function ‘SparseMIndex_endIndex’:
MIndex_class.c:184:27: warning: unused variable ‘poffsets_order’ [-Wunused-variable]
184 | IntAE *poffsets, *poffsets_order;
| ^~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c PreprocessedTB_class.c -o PreprocessedTB_class.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c R_init_Biostrings.c -o R_init_Biostrings.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c RoSeqs_utils.c -o RoSeqs_utils.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c S4Vectors_stubs.c -o S4Vectors_stubs.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c SparseList_utils.c -o SparseList_utils.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c XStringSetList_class.c -o XStringSetList_class.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c XStringSet_class.c -o XStringSet_class.o
XStringSet_class.c: In function ‘new_XStringSet_from_CHARACTER’:
XStringSet_class.c:124:17: warning: ‘lkup_len’ may be used uninitialized in this function [-Wmaybe-uninitialized]
124 | _copy_CHARSXP_to_Chars_holder(&ans_elt_holder, x_elt,
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
125 | INTEGER(start)[i], lkup0, lkup_len);
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c XString_class.c -o XString_class.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c XVector_stubs.c -o XVector_stubs.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c align_needwunsQS.c -o align_needwunsQS.o
align_needwunsQS.c: In function ‘align_needwunsQS’:
align_needwunsQS.c:155:29: warning: ‘sc’ may be used uninitialized in this function [-Wmaybe-uninitialized]
155 | INTEGER(ans_elt)[0] = score;
| ~~~~~~~~~~~~~~~~~~~~^~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c align_pairwiseAlignment.c -o align_pairwiseAlignment.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c align_utils.c -o align_utils.o
align_utils.c: In function ‘PairwiseAlignmentsSingleSubject_align_aligned’:
align_utils.c:250:42: warning: ‘indelWidthSubject’ may be used uninitialized in this function [-Wmaybe-uninitialized]
250 | jPattern += indelWidthSubject;
| ~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
align_utils.c:231:63: warning: ‘indelStartSubject’ may be used uninitialized in this function [-Wmaybe-uninitialized]
231 | if ((numberOfIndelSubject == 0) || (j < indelStartSubject)) {
| ~~~^~~~~~~~~~~~~~~~~~~~
align_utils.c:239:72: warning: ‘indelWidthPattern’ may be used uninitialized in this function [-Wmaybe-uninitialized]
239 | mappedStringPtr[index] = gapCodeValue;
| ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~
align_utils.c:232:78: warning: ‘indelStartPattern’ may be used uninitialized in this function [-Wmaybe-uninitialized]
232 | if ((numberOfIndelPattern == 0) || (jPattern < indelStartPattern)) {
| ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c find_palindromes.c -o find_palindromes.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c gtestsim.c -o gtestsim.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c inject_code.c -o inject_code.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c letter_frequency.c -o letter_frequency.o
letter_frequency.c: In function ‘XStringSet_two_way_letter_frequency’:
letter_frequency.c:957:48: warning: unused variable ‘x_pos’ [-Wunused-variable]
957 | int x_width, y_width, x_length, *ans_mat, i, x_pos;
| ^~~~~
letter_frequency.c:956:13: warning: unused variable ‘ans_dimnames’ [-Wunused-variable]
956 | SEXP ans, ans_dimnames;
| ^~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c lowlevel_matching.c -o lowlevel_matching.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_PWM.c -o match_PWM.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pattern.c -o match_pattern.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pattern_boyermoore.c -o match_pattern_boyermoore.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pattern_indels.c -o match_pattern_indels.o
match_pattern_indels.c:7:13: warning: ‘test_match_pattern_indels’ defined but not used [-Wunused-function]
7 | static void test_match_pattern_indels(const char *p, const char *s,
| ^~~~~~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pattern_shiftor.c -o match_pattern_shiftor.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pdict.c -o match_pdict.o
match_pdict.c: In function ‘vmatch_PDict3Parts_XStringSet’:
match_pdict.c:419:33: warning: ‘ans_col’ may be used uninitialized in this function [-Wmaybe-uninitialized]
419 | ans_col += tb_length;
| ~~~~~~~~^~~~~~~~~~~~
match_pdict.c:392:65: note: ‘ans_col’ was declared here
392 | int tb_length, S_length, collapse0, i, j, match_count, *ans_col;
| ^~~~~~~
match_pdict.c: In function ‘vmatch_XStringSet_XStringSet’:
match_pdict.c:470:41: warning: ‘ans_elt’ may be used uninitialized in this function [-Wmaybe-uninitialized]
470 | ans_elt += P_length;
| ~~~~~~~~^~~~~~~~~~~
match_pdict.c:441:64: note: ‘ans_elt’ was declared here
441 | int P_length, S_length, collapse0, i, j, match_count, *ans_elt;
| ^~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pdict_ACtree2.c -o match_pdict_ACtree2.o
match_pdict_ACtree2.c: In function ‘split_and_move_pointers’:
match_pdict_ACtree2.c:1031:17: warning: variable ‘node0’ set but not used [-Wunused-but-set-variable]
1031 | ACnode *node0, *node1, *node2;
| ^~~~~
match_pdict_ACtree2.c: In function ‘merge_pointers’:
match_pdict_ACtree2.c:1076:17: warning: variable ‘node0’ set but not used [-Wunused-but-set-variable]
1076 | ACnode *node0, *node1, *node2;
| ^~~~~
At top level:
match_pdict_ACtree2.c:602:21: warning: ‘a_nice_max_nodeextbuf_nelt’ defined but not used [-Wunused-function]
602 | static unsigned int a_nice_max_nodeextbuf_nelt(int nnodes)
| ^~~~~~~~~~~~~~~~~~~~~~~~~~
match_pdict_ACtree2.c:139:13: warning: ‘debug_node_counting_functions’ defined but not used [-Wunused-function]
139 | static void debug_node_counting_functions(int maxdepth)
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pdict_Twobit.c -o match_pdict_Twobit.o
match_pdict_Twobit.c: In function ‘build_Twobit’:
match_pdict_Twobit.c:75:27: warning: ‘twobit_sign2pos’ may be used uninitialized in this function [-Wmaybe-uninitialized]
75 | PROTECT(ans_elt = new_XInteger_from_tag("XInteger", twobit_sign2pos));
| ^~~~~~~~~~~~~~~~~~~~~
match_pdict_Twobit.c:110:19: note: ‘twobit_sign2pos’ was declared here
110 | SEXP ans, twobit_sign2pos;
| ^~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_pdict_utils.c -o match_pdict_utils.o
match_pdict_utils.c: In function ‘match_ppheadtail0’:
match_pdict_utils.c:653:56: warning: unused variable ‘ncol’ [-Wunused-variable]
653 | int nelt, min_safe_tb_end, max_safe_tb_end, j, ncol;
| ^~~~
match_pdict_utils.c: In function ‘match_ppheadtail’:
match_pdict_utils.c:713:13: warning: unused variable ‘nelt’ [-Wunused-variable]
713 | int nelt, nkey0, nkey1, nkey2, i, key;
| ^~~~
match_pdict_utils.c: In function ‘_match_pdict_all_flanks’:
match_pdict_utils.c:820:51: warning: unused variable ‘subtotal_NFC’ [-Wunused-variable]
820 | static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
| ^~~~~~~~~~~~
match_pdict_utils.c:820:34: warning: unused variable ‘total_NFC’ [-Wunused-variable]
820 | static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
| ^~~~~~~~~
match_pdict_utils.c:819:40: warning: unused variable ‘NFC’ [-Wunused-variable]
819 | unsigned long int ndup, nloci, NFC; // NFC = Number of Flank Comparisons
| ^~~
match_pdict_utils.c:819:33: warning: unused variable ‘nloci’ [-Wunused-variable]
819 | unsigned long int ndup, nloci, NFC; // NFC = Number of Flank Comparisons
| ^~~~~
match_pdict_utils.c:819:27: warning: unused variable ‘ndup’ [-Wunused-variable]
819 | unsigned long int ndup, nloci, NFC; // NFC = Number of Flank Comparisons
| ^~~~
At top level:
match_pdict_utils.c:820:34: warning: ‘total_NFC’ defined but not used [-Wunused-variable]
820 | static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
| ^~~~~~~~~
match_pdict_utils.c:820:51: warning: ‘subtotal_NFC’ defined but not used [-Wunused-variable]
820 | static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
| ^~~~~~~~~~~~
match_pdict_utils.c:261:13: warning: ‘match_headtail_by_loc’ defined but not used [-Wunused-function]
261 | static void match_headtail_by_loc(const HeadTail *headtail,
| ^~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c match_reporting.c -o match_reporting.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c matchprobes.c -o matchprobes.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c pmatchPattern.c -o pmatchPattern.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c read_fasta_files.c -o read_fasta_files.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c read_fastq_files.c -o read_fastq_files.o
read_fastq_files.c: In function ‘parse_FASTQ_file’:
read_fastq_files.c:392:28: warning: ‘dont_load’ may be used uninitialized in this function [-Wmaybe-uninitialized]
392 | if (dont_load || loader->new_empty_seq_hook == NULL)
| ^
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c replaceAt.c -o replaceAt.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c replace_letter_at.c -o replace_letter_at.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c strutils.c -o strutils.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c translate.c -o translate.o
translate.c: In function ‘DNAStringSet_translate’:
translate.c:110:36: warning: ‘if_ambig0’ may be used uninitialized in this function [-Wmaybe-uninitialized]
110 | if (if_ambig == TRANSLATE_ERROR) {
| ^
translate.c:136:36: note: ‘if_ambig0’ was declared here
136 | int ncodes, if_non_ambig0, if_ambig0, ans_length, i, errcode;
| ^~~~~~~~~
translate.c:106:36: warning: ‘if_non_ambig0’ may be used uninitialized in this function [-Wmaybe-uninitialized]
106 | if (if_non_ambig == TRANSLATE_TO_X)
| ^
translate.c:136:21: note: ‘if_non_ambig0’ was declared here
136 | int ncodes, if_non_ambig0, if_ambig0, ans_length, i, errcode;
| ^~~~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c unstrsplit_methods.c -o unstrsplit_methods.o
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c utils.c -o utils.o
utils.c: In function ‘_get_twobit_signature’:
utils.c:157:16: warning: ‘twobit_sign’ may be used uninitialized in this function [-Wmaybe-uninitialized]
157 | return twobit_sign;
| ^~~~~~~~~~~
utils.c: In function ‘_get_twobit_signature_at’:
utils.c:164:19: warning: ‘twobit_sign’ may be used uninitialized in this function [-Wmaybe-uninitialized]
164 | int i, j, twobit_sign;
| ^~~~~~~~~~~
gcc -I"/home/biocbuild/bbs-3.17-bioc/R/include" -DNDEBUG -I'/home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include' -I'/home/biocbuild/bbs-3.17-bioc/R/library/XVector/include' -I/usr/local/include -fPIC -g -O2 -Wall -c xscat.c -o xscat.o
In file included from /home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include/S4Vectors_defines.h:18,
from /home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include/IRanges_defines.h:18,
from ../inst/include/Biostrings_defines.h:18,
from Biostrings.h:1,
from xscat.c:1:
xscat.c: In function ‘XString_xscat’:
/home/biocbuild/bbs-3.17-bioc/R/include/Rdefines.h:91:33: warning: ‘ans_length’ may be used uninitialized [-Wmaybe-uninitialized]
91 | #define NEW_RAW(n) Rf_allocVector(RAWSXP,n)
| ^~~~~~~~~~~~~~
xscat.c:18:20: note: ‘ans_length’ was declared here
18 | int nargs, ans_length, tag_offset, j;
| ^~~~~~~~~~
xscat.c:52:23: warning: ‘ans_classname’ may be used uninitialized in this function [-Wmaybe-uninitialized]
52 | PROTECT(ans = new_XRaw_from_tag(ans_classname, ans_tag));
| ^~~~~~~~~~~~~~~~~
In file included from /home/biocbuild/bbs-3.17-bioc/R/library/S4Vectors/include/S4Vectors_defines.h:18,
from /home/biocbuild/bbs-3.17-bioc/R/library/IRanges/include/IRanges_defines.h:18,
from ../inst/include/Biostrings_defines.h:18,
from Biostrings.h:1,
from xscat.c:1:
xscat.c: In function ‘XStringSet_xscat’:
/home/biocbuild/bbs-3.17-bioc/R/include/Rdefines.h:85:33: warning: ‘ans_length’ may be used uninitialized [-Wmaybe-uninitialized]
85 | #define NEW_INTEGER(n) Rf_allocVector(INTSXP,n)
| ^~~~~~~~~~~~~~
xscat.c:66:39: note: ‘ans_length’ was declared here
66 | int nargs, *arg_lengths, *ii, ans_length, i, j, *width;
| ^~~~~~~~~~
xscat.c:108:23: warning: ‘ans_element_type’ may be used uninitialized in this function [-Wmaybe-uninitialized]
108 | PROTECT(ans = _alloc_XStringSet(ans_element_type, ans_width));
| ^~~~~~~~~~~~~~~~~
gcc -shared -L/home/biocbuild/bbs-3.17-bioc/R/lib -L/usr/local/lib -o Biostrings.so BAB_class.o BitMatrix.o IRanges_stubs.o MIndex_class.o PreprocessedTB_class.o R_init_Biostrings.o RoSeqs_utils.o S4Vectors_stubs.o SparseList_utils.o XStringSetList_class.o XStringSet_class.o XString_class.o XVector_stubs.o align_needwunsQS.o align_pairwiseAlignment.o align_utils.o find_palindromes.o gtestsim.o inject_code.o letter_frequency.o lowlevel_matching.o match_PWM.o match_pattern.o match_pattern_boyermoore.o match_pattern_indels.o match_pattern_shiftor.o match_pdict.o match_pdict_ACtree2.o match_pdict_Twobit.o match_pdict_utils.o match_reporting.o matchprobes.o pmatchPattern.o read_fasta_files.o read_fastq_files.o replaceAt.o replace_letter_at.o strutils.o translate.o unstrsplit_methods.o utils.o xscat.o -L/home/biocbuild/bbs-3.17-bioc/R/lib -lR
installing to /home/biocbuild/bbs-3.17-bioc/R/library/00LOCK-Biostrings/00new/Biostrings/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
in method for ‘twoWayAlphabetFrequencyByQuality’ with signature ‘"QualityScaledXStringSet"’: no definition for class “QualityScaledXStringSet”
Creating a new generic function for ‘strsplit’ in package ‘Biostrings’
Creating a generic function for ‘ls’ from package ‘base’ in package ‘Biostrings’
Creating a new generic function for ‘pattern’ in package ‘Biostrings’
Creating a new generic function for ‘offset’ in package ‘Biostrings’
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** checking absolute paths in shared objects and dynamic libraries
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (Biostrings)
Biostrings.Rcheck/tests/run_unitTests.Rout
R Under development (unstable) (2023-01-14 r83615) -- "Unsuffered Consequences"
Copyright (C) 2023 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> require("Biostrings") || stop("unable to load Biostrings package")
Loading required package: Biostrings
Loading required package: BiocGenerics
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, aperm, append,
as.data.frame, basename, cbind, colnames, dirname, do.call,
duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin,
pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table,
tapply, union, unique, unsplit, which.max, which.min
Loading required package: S4Vectors
Loading required package: stats4
Attaching package: 'S4Vectors'
The following objects are masked from 'package:base':
I, expand.grid, unname
Loading required package: IRanges
Loading required package: XVector
Loading required package: GenomeInfoDb
Attaching package: 'Biostrings'
The following object is masked from 'package:base':
strsplit
[1] TRUE
> Biostrings:::.test()
RUNIT TEST PROTOCOL -- Fri Feb 24 08:04:46 2023
***********************************************
Number of test functions: 41
Number of errors: 0
Number of failures: 0
1 Test Suite :
Biostrings RUnit Tests - 41 test functions, 0 errors, 0 failures
Number of test functions: 41
Number of errors: 0
Number of failures: 0
Warning messages:
1: In XStringSet("DNA", x, start = start, end = end, width = width, :
metadata columns on input DNAStringSet object were dropped
2: In XStringSet("DNA", x, start = start, end = end, width = width, :
metadata columns on input DNAStringSet object were dropped
3: In XStringSet("DNA", x, start = start, end = end, width = width, :
metadata columns on input DNAStringSet object were dropped
>
> proc.time()
user system elapsed
11.925 0.569 12.585
Biostrings.Rcheck/Biostrings-Ex.timings
| name | user | system | elapsed | |
| AAString-class | 0.004 | 0.001 | 0.005 | |
| AMINO_ACID_CODE | 0.000 | 0.003 | 0.003 | |
| AlignedXStringSet-class | 0.069 | 0.009 | 0.077 | |
| DNAString-class | 0.003 | 0.004 | 0.007 | |
| GENETIC_CODE | 0.012 | 0.001 | 0.013 | |
| HNF4alpha | 0.028 | 0.003 | 0.030 | |
| IUPAC_CODE_MAP | 0.162 | 0.015 | 0.178 | |
| MIndex-class | 0.000 | 0.000 | 0.001 | |
| MaskedXString-class | 0.209 | 0.052 | 0.266 | |
| MultipleAlignment-class | 1.507 | 0.020 | 1.529 | |
| PDict-class | 4.499 | 0.108 | 4.612 | |
| PairwiseAlignments-class | 0.734 | 0.000 | 0.734 | |
| PairwiseAlignments-io | 2.825 | 0.208 | 3.033 | |
| QualityScaledXStringSet-class | 0.183 | 0.008 | 0.192 | |
| RNAString-class | 0.009 | 0.000 | 0.009 | |
| XString-class | 0.010 | 0.000 | 0.009 | |
| XStringQuality-class | 0.183 | 0.000 | 0.183 | |
| XStringSet-class | 12.198 | 0.516 | 12.781 | |
| XStringSet-comparison | 3.995 | 0.097 | 4.093 | |
| XStringSet-io | 9.087 | 0.279 | 9.376 | |
| XStringSetList-class | 0.303 | 0.005 | 0.307 | |
| XStringViews-class | 0.144 | 0.004 | 0.148 | |
| align-utils | 0.043 | 0.004 | 0.048 | |
| chartr | 0.683 | 0.036 | 0.721 | |
| detail | 0.361 | 0.064 | 0.436 | |
| dinucleotideFrequencyTest | 0.011 | 0.004 | 0.016 | |
| findPalindromes | 44.646 | 0.048 | 44.716 | |
| getSeq | 0.049 | 0.013 | 0.062 | |
| gregexpr2 | 0.001 | 0.000 | 0.001 | |
| injectHardMask | 0.049 | 0.004 | 0.052 | |
| letter | 0.026 | 0.000 | 0.027 | |
| letterFrequency | 0.909 | 0.036 | 0.947 | |
| longestConsecutive | 0.000 | 0.000 | 0.001 | |
| lowlevel-matching | 0.590 | 0.024 | 0.614 | |
| maskMotif | 1.533 | 0.056 | 1.594 | |
| match-utils | 0.027 | 0.000 | 0.027 | |
| matchLRPatterns | 0.557 | 0.020 | 0.594 | |